bdSUMO-ZF5.3-GFP-HiBit
(Plasmid
#170992)
-
PurposeFor bacterial expression of bdSUMO tagged muGFP with ZF5.3 peptide and NanoLuc complementation peptide variant #86
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170992 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET His6 MBP TEV LIC cloning vector (2M-T)
- Backbone size w/o insert (bp) 4694
- Total vector size (bp) 5837
-
Vector typeBacterial Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name14x-His-bdSUMO-muGFP-HiBiT
-
SpeciesSynthetic; Brachypodium distachyon
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.08.20.258350v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
bdSUMO-ZF5.3-GFP-HiBit was a gift from Angus Johnston (Addgene plasmid # 170992 ; http://n2t.net/addgene:170992 ; RRID:Addgene_170992) -
For your References section:
Unravelling cytosolic delivery of cell penetrating peptides with a quantitative endosomal escape assay. Teo SLY, Rennick JJ, Yuen D, Al-Wassiti H, Johnston APR, Pouton CW. Nat Commun. 2021 Jun 17;12(1):3721. doi: 10.1038/s41467-021-23997-x. 10.1038/s41467-021-23997-x PubMed 34140497