pTopo RE2 Donor pLox hPGK-Puro pA pLox
(Plasmid
#171049)
-
PurposeDonor template for CRISPR/Cas9 targeting of TERT RE2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTopo pLox hPGK-Puro pA pLox
-
Vector typeMammalian Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePuromycin
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATTCTACCGGGTAGGGGAGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTopo RE2 Donor pLox hPGK-Puro pA pLox was a gift from Agnel Sfeir (Addgene plasmid # 171049 ; http://n2t.net/addgene:171049 ; RRID:Addgene_171049) -
For your References section:
Alternative splicing is a developmental switch for hTERT expression. Penev A, Bazley A, Shen M, Boeke JD, Savage SA, Sfeir A. Mol Cell. 2021 Apr 6. pii: S1097-2765(21)00228-8. doi: 10.1016/j.molcel.2021.03.033. 10.1016/j.molcel.2021.03.033 PubMed 33852895