pLenti pTERT sgRNA1(MS2) mCherry
(Plasmid
#171054)
-
PurposeTargeting of Vp64-dCas9 activation system to hTERT promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepTERT sgRNA1(MS2) mCherry
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti pTERT sgRNA1(MS2) mCherry was a gift from Agnel Sfeir (Addgene plasmid # 171054 ; http://n2t.net/addgene:171054 ; RRID:Addgene_171054) -
For your References section:
Alternative splicing is a developmental switch for hTERT expression. Penev A, Bazley A, Shen M, Boeke JD, Savage SA, Sfeir A. Mol Cell. 2021 Apr 6. pii: S1097-2765(21)00228-8. doi: 10.1016/j.molcel.2021.03.033. 10.1016/j.molcel.2021.03.033 PubMed 33852895