Skip to main content

pET-28a (+)-hTFIIB
(Plasmid #171084)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171084 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-28a
  • Backbone size w/o insert (bp) 5272
  • Total vector size (bp) 6223
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TF2B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    951
  • Entrez Gene
    GTF2B (a.k.a. TF2B, TFIIB)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-28a (+)-hTFIIB was a gift from Joan Conaway (Addgene plasmid # 171084 ; http://n2t.net/addgene:171084 ; RRID:Addgene_171084)
  • For your References section:

    Elongin functions as a loading factor for Mediator at ATF6alpha-regulated ER stress response genes. He Y, Sato S, Tomomori-Sato C, Chen S, Goode ZH, Conaway JW, Conaway RC. Proc Natl Acad Sci U S A. 2021 Sep 28;118(39):e2108751118. doi: 10.1073/pnas.2108751118. 10.1073/pnas.2108751118 PubMed 34544872