Skip to main content

pQ-Elo-HB-C-A(400-772)
(Plasmid #171087)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171087 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQE-2
  • Total vector size (bp) 7317
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Elongin B
  • Alt name
    TCEB2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    357
  • GenBank ID
    NM_007108.3
  • Entrez Gene
    ELOB (a.k.a. SIII, TCEB2)
  • Promoter T5 promoter
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Elongin C
  • Alt name
    TCEB1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    339
  • GenBank ID
    NM_001204857.1
  • Entrez Gene
    ELOC (a.k.a. SIII, TCEB1)
  • Promoter T5 promoter

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Elongin A
  • Alt name
    TCEB3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1125
  • Mutation
    Deleted N-term 26+399 amino acids for mutant expression purpose.
  • GenBank ID
    A0A024RAC6
  • Entrez Gene
    ELOA (a.k.a. ELOA1, SIII, SIII p110, TCEB3, TCEB3A)
  • Promoter T7 promoter

Cloning Information for Gene/Insert 3

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQ-Elo-HB-C-A(400-772) was a gift from Joan Conaway (Addgene plasmid # 171087 ; http://n2t.net/addgene:171087 ; RRID:Addgene_171087)
  • For your References section:

    Elongin functions as a loading factor for Mediator at ATF6alpha-regulated ER stress response genes. He Y, Sato S, Tomomori-Sato C, Chen S, Goode ZH, Conaway JW, Conaway RC. Proc Natl Acad Sci U S A. 2021 Sep 28;118(39):e2108751118. doi: 10.1073/pnas.2108751118. 10.1073/pnas.2108751118 PubMed 34544872