pDP1.2
(Plasmid
#171092)
-
PurposeExpresses cell cycle-dependent OsTIR1 fused with mEmerald and Geminin (1-110). AKA ROLECCS G2(allows integration into AAVS1 safe-harbor)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171092 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMK232 (pBluescript)
-
Backbone manufacturerMasato Kanemaki
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAVS1-CMV-OsTIR1-mEmerald-Geminin-Puro-AAVS1
-
SpeciesH. sapiens (human)
- Promoter CMV
-
Tag
/ Fusion Protein
- Emerald, Geminin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGTACGGTGGGAGGTCTAT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypMK232 CMV-OsTIR1-PURO (Addgene #72834) was used as backbone plasmid for the expression of OsTIR1 from the AAVS1 locus, the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #92139) was used as template for both hGeminin and hCdt1 tags.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.04.23.441203v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDP1.2 was a gift from Dario Palmieri (Addgene plasmid # 171092 ; http://n2t.net/addgene:171092 ; RRID:Addgene_171092) -
For your References section:
A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis. Capece M, Tessari A, Mills J, Vinciguerra GLR, Louke D, Lin C, McElwain BK, Miles WO, Coppola V, Davies AE, Palmieri D, Croce CM. Cell Death Differ. 2023 Aug 3. doi: 10.1038/s41418-023-01191-4. 10.1038/s41418-023-01191-4 PubMed 37537305