pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Ascl1 x2)
(Plasmid
#171099)
-
PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Ascl1.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX458
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 48138)
-
Vector typeCRISPR
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehSpCas9
-
gRNA/shRNA sequenceAscl1 gRNA1: AGCCTGCTTCTTTGCGACCg; Ascl1 gRNA2: AGGGGGCGGTCACAAGTCAG
-
SpeciesM. musculus (mouse); S. pyogenes
-
Entrez GeneAscl1 (a.k.a. ASH1, Mash1, bHLHa46)
- Promoter Ef1a
Cloning Information
- Cloning method Gateway Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Ascl1 x2) was a gift from Joseph Brzezinski (Addgene plasmid # 171099 ; http://n2t.net/addgene:171099 ; RRID:Addgene_171099) -
For your References section:
Initiation of Otx2 expression in the developing mouse retina requires a unique enhancer and either Ascl1 or Neurog2 activity. Kaufman ML, Goodson NB, Park KU, Schwanke M, Office E, Schneider SR, Abraham J, Hensley A, Jones KL, Brzezinski JA. Development. 2021 Jun 15;148(12). pii: 269198. doi: 10.1242/dev.199399. Epub 2021 Jun 18. 10.1242/dev.199399 PubMed 34143204