Skip to main content

pcDNA3HA-AMOT p130∆PPxY1(E104K/E105K)
(Plasmid #171130)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171130 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 8701
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Angiomotin p130 E104K/E105K
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3255
  • Mutation
    changed glutamic acid residues 104 and 105 to lysine, G858D (please see depositor comments)
  • Entrez Gene
    AMOT
  • Tag / Fusion Protein
    • 2xHA (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer CATTTAGGTGACACTATAGAATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note AMOT p130 contains G858D compared to NP_001106962.1. Insert was cloned from Addgene plasmid 3282. This mutation does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3HA-AMOT p130∆PPxY1(E104K/E105K) was a gift from Wesley Sundquist (Addgene plasmid # 171130 ; http://n2t.net/addgene:171130 ; RRID:Addgene_171130)
  • For your References section:

    Interactions between AMOT PPxY Motifs and NEDD4L WW Domains Function in HIV-1 Release. Rheinemann L, Thompson T, Mercenne G, Paine EL, Peterson FC, Volkman BF, Alam SL, Alian A, Sundquist WI. J Biol Chem. 2021 Jul 17:100975. doi: 10.1016/j.jbc.2021.100975. 10.1016/j.jbc.2021.100975 PubMed 34284061