pPPC002
(Plasmid
#171139)
-
PurposeFor integration of J1-J23117-sfGFP, Sp.pCas9-dCas9, and BBa_J23107-MCP-SoxS(R93A/S101A) with miniTn7T method
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC18TminiTn7T-Gm
-
Backbone manufacturerHerbert Schweizer
- Backbone size w/o insert (bp) 4569
- Total vector size (bp) 11273
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAlso resistant to Ampicillin
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameJ1-BBa_J23117-sfGFP
-
SpeciesSynthetic
-
Insert Size (bp)1114
- Promoter J1-BBa_J23117
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer accgaacaggcttatgtcaa
- 3′ sequencing primer TAAGGCTAGTCCGTTATCAACTTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
-
SpeciesS. pyogenes (dCas9), MS2 (MCP), E. coli (SoxS)
-
Insert Size (bp)5642
-
MutationSoxS has R93A and S101A mutations
- Promoter Sp.pCas9, BBa_J23107
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTGTAACTGCTGCTGGGA
- 3′ sequencing primer tgtgggcggacaaaatagttg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternative names: pCDP009, pUC18TminiTn7T-Gm_J1-BBa_J23117-sfGFP_Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A/S101A)
Used for conjugation, with pTNS1 and pRK2013 helper plasmids, to integrate J1-BBa_J23117-sfGFP, Sp.pCas9-dCas9, and BBa_J23107-MCP-SoxS(R93A/S101A) cassettes into gram-negative bacteria.
Point mutation in the FRT site was observed and remained applicable with counterselection by pCK255
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPPC002 was a gift from Jesse Zalatan (Addgene plasmid # 171139 ; http://n2t.net/addgene:171139 ; RRID:Addgene_171139) -
For your References section:
Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida. Kiattisewee C, Dong C, Fontana J, Sugianto W, Peralta-Yahya P, Carothers JM, Zalatan JG. Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002. 10.1016/j.ymben.2021.04.002 PubMed 33930546