Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPPC027.306
(Plasmid #171149)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171149 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPPC020.306
  • Backbone manufacturer
    Jesse Zalatan
  • Backbone size w/o insert (bp) 6261
  • Total vector size (bp) 8324
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Medium Copy in P. putida
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    J306 scRNA
  • Alt name
    TTGTGTCCAGAACGCTCCGT
  • Species
    Synthetic
  • Insert Size (bp)
    525
  • Promoter BBa_J23119

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tttcccagtcacgacgttgt
  • 3′ sequencing primer tgaccatgattacgccaagc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    J3-BBa_J23117-GTPCH_J3-BBa_J23117-PTPS_J3-BBa_J23117-SR
  • Species
    E. coli (GTPCH) and M. alpina (PTPS and SR)
  • Insert Size (bp)
    3136
  • Promoter J3-BBa_J23117

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggggagaggcggtttgcgta
  • 3′ sequencing primer cgtttgtgatggcttccatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternative names: pCK134, pBBR1-GmR_J3-BBa_J23117-GTPCH_J3-BBa_J23117-PTPS_J3-BBa_J23117-SR

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPPC027.306 was a gift from Jesse Zalatan (Addgene plasmid # 171149 ; http://n2t.net/addgene:171149 ; RRID:Addgene_171149)
  • For your References section:

    Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida. Kiattisewee C, Dong C, Fontana J, Sugianto W, Peralta-Yahya P, Carothers JM, Zalatan JG. Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002. 10.1016/j.ymben.2021.04.002 PubMed 33930546