Skip to main content

pPPC031
(Plasmid #171152)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171152 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGNW2-pp1
  • Backbone manufacturer
    Jesse Zalatan
  • Backbone size w/o insert (bp) 6102
  • Total vector size (bp) 7210
  • Modifications to backbone
    Insert homologous region pp1 into pGNW2 plasmid
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    EC1000 pir+
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    J3-BBa_J23117-mRFP
  • Species
    Synthetic
  • Insert Size (bp)
    1164
  • Promoter J3-BBa_J23117

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer accggtggaaaatgatcggc
  • 3′ sequencing primer ttgagaggtgcgtatgacca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternative names: pCK261, pGNW2-pp1_J3-BBa_J23117-mRFP
Single cross-over into P. putida. Then, kanamycin resistant marker can be flipped out by pCK255

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPPC031 was a gift from Jesse Zalatan (Addgene plasmid # 171152 ; http://n2t.net/addgene:171152 ; RRID:Addgene_171152)
  • For your References section:

    Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida. Kiattisewee C, Dong C, Fontana J, Sugianto W, Peralta-Yahya P, Carothers JM, Zalatan JG. Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002. 10.1016/j.ymben.2021.04.002 PubMed 33930546