pPPC034
(Plasmid #171153)

• Purpose: pGNW2 derivative with integration site at P. putida prophage2 for integration of J3(106)-BBa_J23111-sfGFP cassette
• Depositing Lab: Jesse Zalatan
• Publication: Kiattisewee et al Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002.

Backbone

• Vector backbone: pGNW2-pp2
• Backbone manufacturer: Jesse Zalatan
• Backbone size w/o insert (bp): 6102
• Total vector size (bp): 7210
• Modifications to backbone: Insert homologous region pp2 into pGNW2 plasmid
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): EC1000 pir+
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: J3(106)- BBa_J23111-sfGFP
• Species: Synthetic
• Insert Size (bp): 1108
• Promoter: J3(106)-BBa_J23111

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: caccgtcccaccgtacacac
• 3′ sequencing primer: gagttttaatgccacccggc

Resource Information

• Supplemental Documents:
  • pPPC034.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternative names: pCK306, pGNW2-pp2_J3(106)-BBa_J23111-sfGFP
Single cross-over into P. putida. Then, kanamycin resistant marker can be flipped out by pCK255