pPPC034
(Plasmid
#171153)
-
PurposepGNW2 derivative with integration site at P. putida prophage2 for integration of J3(106)-BBa_J23111-sfGFP cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGNW2-pp2
-
Backbone manufacturerJesse Zalatan
- Backbone size w/o insert (bp) 6102
- Total vector size (bp) 7210
-
Modifications to backboneInsert homologous region pp2 into pGNW2 plasmid
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)EC1000 pir+
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameJ3(106)- BBa_J23111-sfGFP
-
SpeciesSynthetic
-
Insert Size (bp)1108
- Promoter J3(106)-BBa_J23111
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caccgtcccaccgtacacac
- 3′ sequencing primer gagttttaatgccacccggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternative names: pCK306, pGNW2-pp2_J3(106)-BBa_J23111-sfGFP
Single cross-over into P. putida. Then, kanamycin resistant marker can be flipped out by pCK255
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPPC034 was a gift from Jesse Zalatan (Addgene plasmid # 171153 ; http://n2t.net/addgene:171153 ; RRID:Addgene_171153) -
For your References section:
Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida. Kiattisewee C, Dong C, Fontana J, Sugianto W, Peralta-Yahya P, Carothers JM, Zalatan JG. Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002. 10.1016/j.ymben.2021.04.002 PubMed 33930546