pWZL-N1ICD-Flag
(Plasmid
#171171)
-
PurposeRetroviral vector for expression of NOTCH1 intracellular domain with a C-terminal FLAG tag (to be used in conjunction with Phoenix packaging cells).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepWZL
- Backbone size w/o insert (bp) 5722
- Total vector size (bp) 8134
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNOTCH1 intracellular domain
-
Alt nameN1ICD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2394
-
MutationWill express residues 1758-2556 of human NOTCH1, as per Capobianco et al, Mol Cell Biol, 1997
-
GenBank IDNM_017617
-
Entrez GeneNOTCH1 (a.k.a. AOS5, AOVD1, TAN1, hN1)
- Promoter Viral LTR
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gag1174 TACATCGTGACCTGGGAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWZL-N1ICD-Flag was a gift from Masashi Narita (Addgene plasmid # 171171 ; http://n2t.net/addgene:171171 ; RRID:Addgene_171171) -
For your References section:
NOTCH1 mediates a switch between two distinct secretomes during senescence. Hoare M, Ito Y, Kang TW, Weekes MP, Matheson NJ, Patten DA, Shetty S, Parry AJ, Menon S, Salama R, Antrobus R, Tomimatsu K, Howat W, Lehner PJ, Zender L, Narita M. Nat Cell Biol. 2016 Sep;18(9):979-92. doi: 10.1038/ncb3397. Epub 2016 Aug 15. 10.1038/ncb3397 PubMed 27525720