pLI_C-tag TNF
(Plasmid
#171178)
-
Purposeinducible expression of C-tag TNF
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171178 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLIX_403
-
Backbone manufacturerDavid Root
- Backbone size w/o insert (bp) 7607
- Total vector size (bp) 8309
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC-tag TNF
-
SpeciesH. sapiens (human)
-
Insert Size (bp)702
-
MutationADAM cleavage site of TNF (AA73-76) was exchanged for the C-tag sequence
- Promoter tight TRE promoter
-
Tag
/ Fusion Protein
- C-tag (internal)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GTATGTCGAGGTAGGCGTGTACG
- 3′ sequencing primer CTGCGTTTCCCGGAACCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLI_C-tag TNF was a gift from Veit Hornung (Addgene plasmid # 171178 ; http://n2t.net/addgene:171178 ; RRID:Addgene_171178) -
For your References section:
C-tag TNF: a reporter system to study TNF shedding. Pinci F, Gaidt MM, Jung C, Kuut G, Jackson MA, Bauernfried S, Hornung V. J Biol Chem. 2020 Dec 25;295(52):18065-18075. doi: 10.1074/jbc.RA120.015248. Epub 2020 Oct 20. 10.1074/jbc.RA120.015248 PubMed 33082141