pMSCV-miR30-shJAG1 #1
(Plasmid
#171196)
-
PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shJAG1 #1 (to be used in conjunction with Phoenix packaging cells).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-miR30
- Backbone size w/o insert (bp) 7039
- Total vector size (bp) 7137
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshJAG1 #1
-
gRNA/shRNA sequenceGCGTGACCTGTGATGACTACT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_000214
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer miR30_F gtaacttgaaagtatttcg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-miR30-shJAG1 #1 was a gift from Masashi Narita (Addgene plasmid # 171196 ; http://n2t.net/addgene:171196 ; RRID:Addgene_171196) -
For your References section:
NOTCH1 mediates a switch between two distinct secretomes during senescence. Hoare M, Ito Y, Kang TW, Weekes MP, Matheson NJ, Patten DA, Shetty S, Parry AJ, Menon S, Salama R, Antrobus R, Tomimatsu K, Howat W, Lehner PJ, Zender L, Narita M. Nat Cell Biol. 2016 Sep;18(9):979-92. doi: 10.1038/ncb3397. Epub 2016 Aug 15. 10.1038/ncb3397 PubMed 27525720