pGEMHE-mH33B-mClover3
(Plasmid
#171496)
-
PurposeT7 promotor drives in vitro transcription of mClover3-tagged mouse H3.3B mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEHME
-
Vector typepGEHME
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH3.3B
-
SpeciesM. musculus (mouse)
-
Entrez GeneH3f3b (a.k.a. 9430068D06Rik, H3-3a, H3-3b, H3.3B)
- Promoter T7
-
Tag
/ Fusion Protein
- mClover3 (C terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13: GTAAAACGACGGCCAGT
- 3′ sequencing primer GGCTACATTTTGGGGGACAACATTTTGTAAAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-mH33B-mClover3 was a gift from Melina Schuh (Addgene plasmid # 171496 ; http://n2t.net/addgene:171496 ; RRID:Addgene_171496) -
For your References section:
Parental genome unification is highly error-prone in mammalian embryos. Cavazza T, Takeda Y, Politi AZ, Aushev M, Aldag P, Baker C, Choudhary M, Bucevicius J, Lukinavicius G, Elder K, Blayney M, Lucas-Hahn A, Niemann H, Herbert M, Schuh M. Cell. 2021 Apr 30. pii: S0092-8674(21)00492-X. doi: 10.1016/j.cell.2021.04.013. 10.1016/j.cell.2021.04.013 PubMed 33964210