pX330A-Prdm14-L4-#2
(Plasmid
#171512)
-
Purposedeletion of a genomic locus in Prdm14 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171512 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx330A
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePrdm14
-
gRNA/shRNA sequenceGGTCTATCTGGCTCCGTTGC
-
SpeciesM. musculus (mouse)
-
Entrez GenePrdm14
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330A-Prdm14-L4-#2 was a gift from Hans Schöler (Addgene plasmid # 171512 ; http://n2t.net/addgene:171512 ; RRID:Addgene_171512) -
For your References section:
Residual pluripotency is required for inductive germ cell segregation. Aramaki S, Kagiwada S, Wu G, Obridge D, Adachi K, Kutejova E, Lickert H, Hubner K, Scholer HR. EMBO Rep. 2021 Aug 4;22(8):e52553. doi: 10.15252/embr.202152553. Epub 2021 Jun 22. 10.15252/embr.202152553 PubMed 34156139