pJRH056
(Plasmid
#171637)
-
PurposePlasmid containing a U6 promoter expressing a spyCas9 tdTom sgRNA298 and CAG promoter expressing mTagBFP2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCustom
- Backbone size w/o insert (bp) 4230
- Total vector size (bp) 4943
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namespyCas9 sgRNA-tdTomato
-
Insert Size (bp)20
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GCTGTTAGAGAGATAATTGG
- 3′ sequencing primer TATTGGCGTTACTATTGACG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemTagBFP2
-
Insert Size (bp)689
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TAATTACCTGGAGCACCTGC
- 3′ sequencing primer CTCATTTTATTAGGAAAGGACAGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJRH056 was a gift from Jennifer Doudna (Addgene plasmid # 171637 ; http://n2t.net/addgene:171637 ; RRID:Addgene_171637) -
For your References section:
Targeted delivery of CRISPR-Cas9 and transgenes enables complex immune cell engineering. Hamilton JR, Tsuchida CA, Nguyen DN, Shy BR, McGarrigle ER, Sandoval Espinoza CR, Carr D, Blaeschke F, Marson A, Doudna JA. Cell Rep. 2021 Jun 1;35(9):109207. doi: 10.1016/j.celrep.2021.109207. 10.1016/j.celrep.2021.109207 PubMed 34077734