T7-LacO-GFP_ColE1
(Plasmid #171648)

• Purpose: Expresses GFP in BL21(DE3) E. coli. Positive control for expression experiments. Contains ColE1 origin of replication.
• Depositing Lab: Tara Deans
• Publication: MacDonald et al Nat Commun. 2021 Jul 5;12(1):4109. doi: 10.1038/s41467-021-24434-9.

Backbone

• Vector backbone: Amp-ColE-T1 Stop
• Backbone size w/o insert (bp): 2029
• Total vector size (bp): 2979
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: T7-LacO-GFPssrA-T7 Stop
• Insert Size (bp): 951
• Promoter: T7
• Tag / Fusion Protein:
  • ssrA degradation tag (DAS+4) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GAATAGTGTATGCGGCGACC
• 3′ sequencing primer: CCTAGGGCGTTCGGCT

Resource Information

• Supplemental Documents:
  • T7lacO-GFP-ColEI.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry