T7-LacO-GFP_ColE1
(Plasmid
#171648)
-
PurposeExpresses GFP in BL21(DE3) E. coli. Positive control for expression experiments. Contains ColE1 origin of replication.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171648 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAmp-ColE-T1 Stop
- Backbone size w/o insert (bp) 2029
- Total vector size (bp) 2979
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT7-LacO-GFPssrA-T7 Stop
-
Insert Size (bp)951
- Promoter T7
-
Tag
/ Fusion Protein
- ssrA degradation tag (DAS+4) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAATAGTGTATGCGGCGACC
- 3′ sequencing primer CCTAGGGCGTTCGGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7-LacO-GFP_ColE1 was a gift from Tara Deans (Addgene plasmid # 171648 ; http://n2t.net/addgene:171648 ; RRID:Addgene_171648) -
For your References section:
Enhanced regulation of prokaryotic gene expression by a eukaryotic transcriptional activator. MacDonald IC, Seamons TR, Emmons JC, Javdan SB, Deans TL. Nat Commun. 2021 Jul 5;12(1):4109. doi: 10.1038/s41467-021-24434-9. 10.1038/s41467-021-24434-9 PubMed 34226549