Skip to main content

QUAS-0-T7-CcdB_ColE1
(Plasmid #171652)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171652 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    QUAS-0-T7-GFP_ColE1
  • Backbone size w/o insert (bp) 2071
  • Total vector size (bp) 2445
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CcdB-ssrA
  • Insert Size (bp)
    374
  • Promoter T7
  • Tag / Fusion Protein
    • ssrA degradation tag (DAS+4) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CACCAGCGTTTCTGGGTG
  • 3′ sequencing primer GCTCACATGTTCTTTCCTGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    QUAS-0-T7-CcdB_ColE1 was a gift from Tara Deans (Addgene plasmid # 171652 ; http://n2t.net/addgene:171652 ; RRID:Addgene_171652)
  • For your References section:

    Enhanced regulation of prokaryotic gene expression by a eukaryotic transcriptional activator. MacDonald IC, Seamons TR, Emmons JC, Javdan SB, Deans TL. Nat Commun. 2021 Jul 5;12(1):4109. doi: 10.1038/s41467-021-24434-9. 10.1038/s41467-021-24434-9 PubMed 34226549