T7-LacO-TetR_p15A
(Plasmid
#171664)
-
PurposeExpression of TetR in BL21(DE3) E. coli. Contains p15A origin of replication.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneT7-LacO-QF_p15A
- Backbone size w/o insert (bp) 1986
- Total vector size (bp) 2805
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameT7-LacO-TetR-T7 Stop
-
Insert Size (bp)819
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AatII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTGCAATCCATCTTGTTCAATCATGC
- 3′ sequencing primer CGAAAAACCGCCCTGCAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7-LacO-TetR_p15A was a gift from Tara Deans (Addgene plasmid # 171664 ; http://n2t.net/addgene:171664 ; RRID:Addgene_171664) -
For your References section:
Enhanced regulation of prokaryotic gene expression by a eukaryotic transcriptional activator. MacDonald IC, Seamons TR, Emmons JC, Javdan SB, Deans TL. Nat Commun. 2021 Jul 5;12(1):4109. doi: 10.1038/s41467-021-24434-9. 10.1038/s41467-021-24434-9 PubMed 34226549