Skip to main content
Addgene

pSunS 1-335
(Plasmid #171673)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171673 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28b
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 5293
  • Total vector size (bp) 6301
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Glycosyltransferase SunS
  • Alt name
    SunS
  • Species
    Bacillus subtilis (strain 168)
  • Insert Size (bp)
    1008
  • Entrez Gene
    sunS (a.k.a. BSU_21450, BSU21450)
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSunS 1-335 was a gift from Wilfred van der Donk (Addgene plasmid # 171673 ; http://n2t.net/addgene:171673 ; RRID:Addgene_171673)
  • For your References section:

    Structural and mechanistic investigations of protein S-glycosyltransferases. Fujinami D, Garcia de Gonzalo CV, Biswas S, Hao Y, Wang H, Garg N, Lukk T, Nair SK, van der Donk WA. Cell Chem Biol. 2021 Dec 16;28(12):1740-1749.e6. doi: 10.1016/j.chembiol.2021.06.009. Epub 2021 Jul 21. 10.1016/j.chembiol.2021.06.009 PubMed 34283964