pSunS 1-335
(Plasmid
#171673)
-
PurposeSunS 1-335 expression in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171673 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28b
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 5293
- Total vector size (bp) 6301
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGlycosyltransferase SunS
-
Alt nameSunS
-
SpeciesBacillus subtilis (strain 168)
-
Insert Size (bp)1008
-
Entrez GenesunS (a.k.a. BSU_21450, BSU21450)
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSunS 1-335 was a gift from Wilfred van der Donk (Addgene plasmid # 171673 ; http://n2t.net/addgene:171673 ; RRID:Addgene_171673) -
For your References section:
Structural and mechanistic investigations of protein S-glycosyltransferases. Fujinami D, Garcia de Gonzalo CV, Biswas S, Hao Y, Wang H, Garg N, Lukk T, Nair SK, van der Donk WA. Cell Chem Biol. 2021 Dec 16;28(12):1740-1749.e6. doi: 10.1016/j.chembiol.2021.06.009. Epub 2021 Jul 21. 10.1016/j.chembiol.2021.06.009 PubMed 34283964