CBM9-(PT4)P
(Plasmid
#171708)
-
PurposeCarries CBM9 fusion tag
-
Depositing Lab
-
Depositing OrganizationUniversity of Victoria
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepRSET5A
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 3500
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)T7 Express lysY/Iq, NEB #C3013I
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCellulose Bindind Protein 9
-
Alt nameCBM9
-
SpeciesThermatoga maritima
-
Insert Size (bp)674
-
GenBank IDAE000512.1 MZ322548
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer AAGGTCAGCGTGTTGGTATC nFseq5A GATCTCGATCCCGCGAAATTAATAC
- 3′ sequencing primer nRseq5A AAACCCCTCAAGACCCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CBM9-(PT4)P was a gift from Francis Nano (Addgene plasmid # 171708 ; http://n2t.net/addgene:171708 ; RRID:Addgene_171708) -
For your References section:
Escherichia coli recombinant expression of SARS-CoV-2 protein fragments. McGuire BE, Mela JE, Thompson VC, Cucksey LR, Stevens CE, McWhinnie RL, Winkler DFH, Pelech S, Nano FE. Microb Cell Fact. 2022 Feb 5;21(1):21. doi: 10.1186/s12934-022-01753-0. 10.1186/s12934-022-01753-0 PubMed 35123472