Skip to main content

MGAT2-RpHLuorin2
(Plasmid #171718)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171718 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 171718-D50 50 μg of DNA in Tris buffer $495
DNA 171718-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pRpHluorin-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4730
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ratiometric pHLuorin2 fused to MGAT2
  • Alt name
    Alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_002408.3
  • Entrez Gene
    MGAT2 (a.k.a. CDG2A, CDGS2, GLCNACTII, GNT-II, GNT2)
  • Promoter CMV
  • Tag / Fusion Protein
    • ratiometric pHluorin2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Ratiometric pHLuorin2 sequence synthesized by Genscript, original sequence from https://www.scirp.org/journal/paperinformation.aspx?paperid=5043

Targeting to the MGAT2-positive compartment was achieved by inserting synthetic truncated MGAT2 (residues 1-89 of Uniprot Q10469, Genscript)

The starting codon of RpHLuorin2 was removed and a flexible GGSGGS linker was added between the two protein fragments.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MGAT2-RpHLuorin2 was a gift from Geert van den Bogaart (Addgene plasmid # 171718 ; http://n2t.net/addgene:171718 ; RRID:Addgene_171718)
  • For your References section:

    Fluorescence Lifetime Imaging of pH along the Secretory Pathway. Linders PTA, Ioannidis M, Ter Beest M, van den Bogaart G. ACS Chem Biol. 2022 Jan 21;17(1):240-251. doi: 10.1021/acschembio.1c00907. Epub 2022 Jan 10. 10.1021/acschembio.1c00907 PubMed 35000377