-
PurposeLysosomal expression of ratiometric pHLuorin2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRpHluorin-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4730
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRatiometric pHLuorin2 fused to LAMP1
-
Alt nameCD107a, LAMPA, LGP120
-
SpeciesH. sapiens (human)
-
GenBank IDNM_005561.3
-
Entrez GeneLAMP1 (a.k.a. CD107a, LAMPA, LGP120)
- Promoter CMV
-
Tag
/ Fusion Protein
- ratiometric pHluorin2 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLAMP1 was cloned from Addgene plasmid #34831
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Targeting to LAMP1-positive compartments was achieved by inserting the signal sequence of LAMP1 (LAMP1-mGFP74, Addgene plasmid #34831) N-terminal to RpHLuorin2 with restriction sites HindIII and AgeI. Then, the luminal domain of LAMP1 was placed C-terminal to RpHLuorin2 after a flexible GSGS linker with restriction sites BsrGI and NotI.
Ratiometric pHLuorin2 sequence synthesized by Genscript, original sequence from https://www.scirp.org/journal/paperinformation.aspx?paperid=5043
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LAMP1-RpHLuorin2 was a gift from Geert van den Bogaart (Addgene plasmid # 171720 ; http://n2t.net/addgene:171720 ; RRID:Addgene_171720) -
For your References section:
Fluorescence Lifetime Imaging of pH along the Secretory Pathway. Linders PTA, Ioannidis M, Ter Beest M, van den Bogaart G. ACS Chem Biol. 2022 Jan 21;17(1):240-251. doi: 10.1021/acschembio.1c00907. Epub 2022 Jan 10. 10.1021/acschembio.1c00907 PubMed 35000377