Skip to main content

pHR-PGK-LexA-WW-CIB1-biLINuS
(Plasmid #171757)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171757 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR-PGK
  • Backbone size w/o insert (bp) 8941
  • Total vector size (bp) 10834
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synthetic gene containing LexA-WW-CIB1-biLINuS
  • Alt name
    LexA-WW-CIB1-biLINuS
  • Species
    Synthetic
  • Insert Size (bp)
    1893
  • Promoter PGK

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccaatagcagctttgctccttc
  • 3′ sequencing primer tgatatcaagcttgcatgcctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-PGK-LexA-WW-CIB1-biLINuS was a gift from Yingxiao Wang (Addgene plasmid # 171757 ; http://n2t.net/addgene:171757 ; RRID:Addgene_171757)
  • For your References section:

    Engineering light-controllable CAR T cells for cancer immunotherapy. Huang Z, Wu Y, Allen ME, Pan Y, Kyriakakis P, Lu S, Chang YJ, Wang X, Chien S, Wang Y. Sci Adv. 2020 Feb 19;6(8):eaay9209. doi: 10.1126/sciadv.aay9209. eCollection 2020 Feb. 10.1126/sciadv.aay9209 PubMed 32128416