Skip to main content
Addgene

pHR-LexAOx4-Pmin-Cre
(Plasmid #171759)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171759 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre recombinase
  • Species
    P1 bacteriophage
  • Insert Size (bp)
    1032
  • Promoter minimal promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gatctcgacggtcgccaaatg
  • 3′ sequencing primer tgatatcaagcttgcatgcctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-LexAOx4-Pmin-Cre was a gift from Yingxiao Wang (Addgene plasmid # 171759 ; http://n2t.net/addgene:171759 ; RRID:Addgene_171759)
  • For your References section:

    Engineering light-controllable CAR T cells for cancer immunotherapy. Huang Z, Wu Y, Allen ME, Pan Y, Kyriakakis P, Lu S, Chang YJ, Wang X, Chien S, Wang Y. Sci Adv. 2020 Feb 19;6(8):eaay9209. doi: 10.1126/sciadv.aay9209. eCollection 2020 Feb. 10.1126/sciadv.aay9209 PubMed 32128416