AAVS1-Puro CAG PSMA nanobody T-CAR
(Plasmid
#171962)
-
PurposeDonor plasmid for PSMA nanobody T-CAR expression in human cells
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAddgene Plasmid #136934
- Backbone size w/o insert (bp) 10225
- Total vector size (bp) 11735
-
Vector typeMammalian Expression, CRISPR, TALEN, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynthetic anti-PSMA nanobody CAR
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1510
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer gctaaccatgttcatgccttc
- 3′ sequencing primer none (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Puro CAG PSMA nanobody T-CAR was a gift from Xiaoping Bao (Addgene plasmid # 171962 ; http://n2t.net/addgene:171962 ; RRID:Addgene_171962) -
For your References section:
Engineered anti-prostate cancer CAR-neutrophils from human pluripotent stem cells. Harris JD, Chang Y, Syahirah R, Lian XL, Deng Q, Bao X. J Immunol Regen Med. 2023 May;20:100074. doi: 10.1016/j.regen.2023.100074. Epub 2023 Apr 1. 10.1016/j.regen.2023.100074 PubMed 37089616