Skip to main content

pGL3-Promoter-hPE(-)-Luc
(Plasmid #172004)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172004 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3-Promoter
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5010
  • Total vector size (bp) 9374
  • Vector type
    Mammalian Expression, Bacterial Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human PE sequence (hPE)
  • Alt name
    Human PTEN Enhancer sequence (hPE)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4364
  • Promoter SV40 Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer agtactaacatacgctctcc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Promoter-hPE(-)-Luc was a gift from Daniel Herranz (Addgene plasmid # 172004 ; http://n2t.net/addgene:172004 ; RRID:Addgene_172004)
  • For your References section:

    A Tumor Suppressor Enhancer of PTEN in T-cell development and leukemia. Tottone L, Lancho O, Loh JW, Singh A, Kimura S, Roels J, Kuchmiy A, Strubbe S, Lawlor MA, da Silva-Diz V, Luo S, Gachet S, Garcia-Prieto CA, Hagelaar R, Esteller M, Meijerink JPP, Soulier J, Taghon T, Van Vlierberghe P, Mullighan CG, Khiabanian H, Rocha PP, Herranz D. Blood Cancer Discov. 2021 Jan;2(1):92-109. doi: 10.1158/2643-3230.BCD-20-0201. Epub 2020 Nov 24. 10.1158/2643-3230.BCD-20-0201 PubMed 33458694