Skip to main content

IMPT-2070
(Plasmid #172092)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172092 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac1
  • Backbone manufacturer
    ThermoFisher
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 4800
  • Modifications to backbone
    gp64 promoter has replaced polyhedrin promoter
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homo sapiens adenosine A2a receptor (ADORA2A)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1344
  • GenBank ID
    NM_001278499.2
  • Entrez Gene
    ADORA2A (a.k.a. A2aR, ADORA2, RDC8)
  • Promoter gp64
  • Tag / Fusion Protein
    • cytochrome b562RIL

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CTA ACA ACG TGC CTT GTG TCA CGT
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    IMPT-2070 was a gift from Raymond Stevens (Addgene plasmid # 172092 ; http://n2t.net/addgene:172092 ; RRID:Addgene_172092)
  • For your References section:

    Structural basis for allosteric regulation of GPCRs by sodium ions. Liu W, Chun E, Thompson AA, Chubukov P, Xu F, Katritch V, Han GW, Roth CB, Heitman LH, IJzerman AP, Cherezov V, Stevens RC. Science. 2012 Jul 13;337(6091):232-6. doi: 10.1126/science.1219218. 10.1126/science.1219218 PubMed 22798613