Skip to main content
Addgene

pRabies-EGFP-rtTAn
(Plasmid #172119)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 172119 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSADdeltaG-F3
  • Backbone manufacturer
    Addgene(#32634)
  • Backbone size w/o insert (bp) 15034
  • Vector type
    Rabies Virus
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP, rtTAn-InteinN
  • Species
    Synthetic
  • Insert Size (bp)
    1690
  • Promoter CMV

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ccgctgcatttcatcaaagtc
  • 3′ sequencing primer aggttgagaagtgttgccag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    EGFP from pWPI-EGFP-Puro, rtTAN from pLVX-TetOne-Puro(Clontech), InteinN from pLKO-GFP-IntN-ddFKBP (An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function. Deng Pan, et al. Sci Rep, 2016. 6: p. 26167.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Used Infusion cloning. 5' cloning site: SbfI (not destroyed), 3' cloning site: AscI (not destroyed). Please visit https://www.biorxiv.org/content/10.1101/2021.04.05.438407v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRabies-EGFP-rtTAn was a gift from Chun Xu (Addgene plasmid # 172119 ; http://n2t.net/addgene:172119 ; RRID:Addgene_172119)
  • For your References section:

    An intein-split transactivator for intersectional neural imaging and optogenetic manipulation. Chen HS, Zhang XL, Yang RR, Wang GL, Zhu XY, Xu YF, Wang DY, Zhang N, Qiu S, Zhan LJ, Shen ZM, Xu XH, Long G, Xu C. Nat Commun. 2022 Jun 23;13(1):3605. doi: 10.1038/s41467-022-31255-x. 10.1038/s41467-022-31255-x PubMed 35739125