Skip to main content

pTF101.1gw3
(Plasmid #172181)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172181 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTF101.1
  • Backbone manufacturer
    Kan Wang
  • Backbone size w/o insert (bp) 9189
  • Total vector size (bp) 10979
  • Modifications to backbone
    attR3-CmR-ccdB-attR4 cassette was inserted for Gateway cloning.
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    attR3-CmR-ccdB-attR4
  • Species
    Synthetic
  • Insert Size (bp)
    1704
  • Promoter lacUV5 promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cggataacaatttcacacag
  • 3′ sequencing primer caggaaacagctatgaccat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there are minor differences between the Addgene verified sequence and the depositor's reference sequence. These differences do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTF101.1gw3 was a gift from Kan Wang (Addgene plasmid # 172181 ; http://n2t.net/addgene:172181 ; RRID:Addgene_172181)
  • For your References section:

    Improved cotyledonary node method using an alternative explant derived from mature seed for efficient Agrobacterium-mediated soybean transformation. Paz MM, Martinez JC, Kalvig AB, Fonger TM, Wang K. Plant Cell Rep. 2006 Mar;25(3):206-13. doi: 10.1007/s00299-005-0048-7. Epub 2005 Oct 25. 10.1007/s00299-005-0048-7 PubMed 16249869