pTF101.1gw3
(Plasmid
#172181)
-
PurposeA binary plasmid for gateway 3-Entry in pTF101.1 background (attR1 & attR2) containing double CaMV 35S promoter and TEV enhancer to drive bialophos resistance gene (bar) for plant transformation.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172181 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTF101.1
-
Backbone manufacturerKan Wang
- Backbone size w/o insert (bp) 9189
- Total vector size (bp) 10979
-
Modifications to backboneattR3-CmR-ccdB-attR4 cassette was inserted for Gateway cloning.
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameattR3-CmR-ccdB-attR4
-
SpeciesSynthetic
-
Insert Size (bp)1704
- Promoter lacUV5 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cggataacaatttcacacag
- 3′ sequencing primer caggaaacagctatgaccat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are minor differences between the Addgene verified sequence and the depositor's reference sequence. These differences do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTF101.1gw3 was a gift from Kan Wang (Addgene plasmid # 172181 ; http://n2t.net/addgene:172181 ; RRID:Addgene_172181) -
For your References section:
Improved cotyledonary node method using an alternative explant derived from mature seed for efficient Agrobacterium-mediated soybean transformation. Paz MM, Martinez JC, Kalvig AB, Fonger TM, Wang K. Plant Cell Rep. 2006 Mar;25(3):206-13. doi: 10.1007/s00299-005-0048-7. Epub 2005 Oct 25. 10.1007/s00299-005-0048-7 PubMed 16249869