Skip to main content

2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_bKO
(Plasmid #172225)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172225 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    2X_pX458_pSpCas9(BB)-2A-GFP (Plasmid #172221)
  • Backbone manufacturer
    Alexander Meissner
  • Backbone size w/o insert (bp) 9699
  • Total vector size (bp) 9703
  • Modifications to backbone
    Two sgRNAs targeting the centromeric human SOX17 CTCF-boundary are cloned into the BbsI (not restored) and SapI (not restored) site.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    ACATCCAGTCTGCCAACATA, GGGCTGCACCAAATCGCCAC
  • Species
    H. sapiens (human)
  • GenBank ID
    hg19, chr8:55077824-55077843 hg19, chr8:55083011-55083030
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    sgRNAs were ordered from Sigma-Aldrich as synthetic ssODN oligonucleotides.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_bKO was a gift from Alexander Meissner (Addgene plasmid # 172225 ; http://n2t.net/addgene:172225 ; RRID:Addgene_172225)
  • For your References section:

    Topological isolation of developmental regulators in mammalian genomes. Wu HJ, Landshammer A, Stamenova EK, Bolondi A, Kretzmer H, Meissner A, Michor F. Nat Commun. 2021 Aug 12;12(1):4897. doi: 10.1038/s41467-021-24951-7. 10.1038/s41467-021-24951-7 PubMed 34385432