2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_bKO
(Plasmid
#172225)
-
PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the centromeric human SOX17 CTCF-boundary.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbone2X_pX458_pSpCas9(BB)-2A-GFP (Plasmid #172221)
-
Backbone manufacturerAlexander Meissner
- Backbone size w/o insert (bp) 9699
- Total vector size (bp) 9703
-
Modifications to backboneTwo sgRNAs targeting the centromeric human SOX17 CTCF-boundary are cloned into the BbsI (not restored) and SapI (not restored) site.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequenceACATCCAGTCTGCCAACATA, GGGCTGCACCAAATCGCCAC
-
SpeciesH. sapiens (human)
-
GenBank IDhg19, chr8:55077824-55077843 hg19, chr8:55083011-55083030
- Promoter Cbh
-
Tags
/ Fusion Proteins
- 3XFLAG (N terminal on insert)
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer n.a.
- 3′ sequencing primer ggaaagtccctattggcgtta
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bysgRNAs were ordered from Sigma-Aldrich as synthetic ssODN oligonucleotides.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_bKO was a gift from Alexander Meissner (Addgene plasmid # 172225 ; http://n2t.net/addgene:172225 ; RRID:Addgene_172225) -
For your References section:
Topological isolation of developmental regulators in mammalian genomes. Wu HJ, Landshammer A, Stamenova EK, Bolondi A, Kretzmer H, Meissner A, Michor F. Nat Commun. 2021 Aug 12;12(1):4897. doi: 10.1038/s41467-021-24951-7. 10.1038/s41467-021-24951-7 PubMed 34385432