pAAV-phSyn-flex-SypHaloTag
(Plasmid
#172280)
-
PurposeCre-dependent HaloTag labeling of neuronal presynaptic terminals from the synapsin promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV-phSyn
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesynaptophysin-HaloTag
-
SpeciesSynthetic
-
Insert Size (bp)3400
-
GenBank IDNM_009305.2
- Promoter rat synapsin
-
Tag
/ Fusion Protein
- HaloTag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcgtgtcgtgcctgagagcg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis construct was derived from two Addgene constructs #153203 and #29644, replacing the EGFP from #153203 (a gift from Lynette Lim) with the HaloTag from #29644 (a gift from Eric Campeau).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-phSyn-flex-SypHaloTag was a gift from Danny Winder (Addgene plasmid # 172280 ; http://n2t.net/addgene:172280 ; RRID:Addgene_172280)