pAAV-Sst12-GFP
(Plasmid
#172311)
-
PurposeSST interneuron-restricted gene regulatory element GRE12, to drive GFP expression in SST+ interneurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-mDlx-GFP-Fishell-1
-
Backbone manufacturerAddgene # 83900
- Backbone size w/o insert (bp) 4954
- Total vector size (bp) 5700
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSst12
-
Alt nameGRE12
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)746
- Promoter pB-Globin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer tcactaggggttcctgcgg
- 3′ sequencing primer tgggcataaaagtcagggcaga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Sst12-GFP was a gift from Michael Greenberg (Addgene plasmid # 172311 ; http://n2t.net/addgene:172311 ; RRID:Addgene_172311) -
For your References section:
A scalable platform for the development of cell-type-specific viral drivers. Hrvatin S, Tzeng CP, Nagy MA, Stroud H, Koutsioumpa C, Wilcox OF, Assad EG, Green J, Harvey CD, Griffith EC, Greenberg ME. Elife. 2019 Sep 23;8. pii: 48089. doi: 10.7554/eLife.48089. 10.7554/eLife.48089 PubMed 31545165