Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RUSH reporter-HMGB1-SBP-GFP
(Plasmid #172357)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172357 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDH-CMV-MCS-EF1-puro
  • Backbone manufacturer
    system biosciences
  • Backbone size w/o insert (bp) 7367
  • Total vector size (bp) 8898
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    high mobility group box 1
  • Alt name
    HMGB1
  • Species
    H. sapiens (human)
  • GenBank ID
    NM.002128.4
  • Entrez Gene
    HMGB1 (a.k.a. HMG-1, HMG1, HMG3, SBP-1)
  • Promoter CMV
  • Tag / Fusion Protein
    • SBP-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RUSH reporter-HMGB1-SBP-GFP was a gift from Guido Kroemer (Addgene plasmid # 172357 ; http://n2t.net/addgene:172357 ; RRID:Addgene_172357)
  • For your References section:

    Identification of pharmacological agents that induce HMGB1 release. Liu P, Zhao L, Loos F, Iribarren K, Lachkar S, Zhou H, Gomes-da-Silva LC, Chen G, Bezu L, Boncompain G, Perez F, Zitvogel L, Kepp O, Kroemer G. Sci Rep. 2017 Nov 2;7(1):14915. doi: 10.1038/s41598-017-14848-1. 10.1038/s41598-017-14848-1 PubMed 29097772