CVS-N2c-EGFP-ChIEF
(Plasmid
#172371)
-
PurposeProduction of RVdG-CVS-N2c viral vectors for cell-type specific trans-synaptic retrograde labeling.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172371 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneRabies CVS N2c(deltaG)
-
Backbone manufacturerMatthias J. Schnell, Thomas Jefferson University
- Backbone size w/o insert (bp) 14070
-
Vector typeNeurotropic virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEGFP + ChIEF
-
SpeciesOther
-
Insert Size (bp)1824
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GGAGGTTATCCTCGGGACTGGAATCG
- 3′ sequencing primer GCCTCTTGGATGTGAAAAAAACTATTAACATCCCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.12.23.474014 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CVS-N2c-EGFP-ChIEF was a gift from Yoav Ben-Simon & Peter Jonas (Addgene plasmid # 172371 ; http://n2t.net/addgene:172371 ; RRID:Addgene_172371) -
For your References section:
Fast, high-throughput production of improved rabies viral vectors for specific, efficient and versatile transsynaptic retrograde labeling. Sumser A, Joesch M, Jonas P, Ben-Simon Y. Elife. 2022 Aug 30;11:e79848. doi: 10.7554/eLife.79848. 10.7554/eLife.79848 PubMed 36040301