MAC-TOP3B
(Plasmid
#172423)
-
PurposeMAC-tagged gene expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backboneMAC-tag-N
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameC-type lectin domain family 4 member D (CD antigen CD368)
-
Alt nameCLEC4D
-
SpeciesH. sapiens (human)
-
Entrez GeneCLEC4D (a.k.a. CD368, CLEC-6, CLEC6, CLECSF8, Dectin-3, MCL, MPCL)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- MAC-tag (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMVfor :CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer pCR3.1-BGHrev: TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MAC-TOP3B was a gift from Markku Varjosalo (Addgene plasmid # 172423 ; http://n2t.net/addgene:172423 ; RRID:Addgene_172423) -
For your References section:
SARS-CoV-2-host proteome interactions for antiviral drug discovery. Liu X, Huuskonen S, Laitinen T, Redchuk T, Bogacheva M, Salokas K, Pohner I, Ohman T, Tonduru AK, Hassinen A, Gawriyski L, Keskitalo S, Vartiainen MK, Pietiainen V, Poso A, Varjosalo M. Mol Syst Biol. 2021 Nov;17(11):e10396. doi: 10.15252/msb.202110396. 10.15252/msb.202110396 PubMed 34709727