Skip to main content
Addgene

pX458_sgRNA_Ago1_6
(Plasmid #172471)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172471 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX458
  • Backbone manufacturer
    Feng Zhang Lab (addgene#: 48138)
  • Backbone size w/o insert (bp) 9272
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgAgo1
  • gRNA/shRNA sequence
    GGCAGCTTTCCAGTGGAAGA
  • Species
    M. musculus (mouse)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the Addgene verified sequence differs slightly from the depositor sequence. These differences do not alter plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458_sgRNA_Ago1_6 was a gift from Constance Ciaudo (Addgene plasmid # 172471 ; http://n2t.net/addgene:172471 ; RRID:Addgene_172471)
  • For your References section:

    AGO1 regulates pericentromeric regions in mouse embryonic stem cells. Muller M, Fah T, Schaefer M, Hermes V, Luitz J, Stalder P, Arora R, Ngondo RP, Ciaudo C. Life Sci Alliance. 2022 Mar 2;5(6). pii: 5/6/e202101277. doi: 10.26508/lsa.202101277. Print 2022 Jun. 10.26508/lsa.202101277 PubMed 35236760