pGJK_His-SUMO-LbuCas13a
(Plasmid #172488)

• Purpose: Bacterial expression of codon-optimized His-SUMO-LbuCas13a.
• Depositing Lab: Jennifer Doudna
• Publication: Liu et al Nat Chem Biol. 2021 Sep;17(9):982-988. doi: 10.1038/s41589-021-00842-2. Epub 2021 Aug 5.

Backbone

• Vector backbone: pET-28a(+)
• Total vector size (bp): 9070
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: bdSUMO-LbuCas13a (codon-optimized)
• Alt name: c2c2
• Alt name: Leptotrichia buccalis cas13a
• Species: Synthetic
• Promoter: T7 promoter and lac operator
• Tags / Fusion Proteins:
  • His6 (N terminal on backbone)
  • bdSUMO (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pGJK_His-SUMO-LbuCas13a.gb
• A portion of this plasmid was derived from a plasmid made by: GenScript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.medrxiv.org/content/10.1101/2021.03.19.21253328v1 for medRxiv preprint.