Skip to main content

pGJK_His-SUMO-LbuCas13a
(Plasmid #172488)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172488 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET-28a(+)
  • Total vector size (bp) 9070
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    bdSUMO-LbuCas13a (codon-optimized)
  • Alt name
    c2c2
  • Alt name
    Leptotrichia buccalis cas13a
  • Species
    Synthetic
  • Promoter T7 promoter and lac operator
  • Tags / Fusion Proteins
    • His6 (N terminal on backbone)
    • bdSUMO (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GenScript
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGJK_His-SUMO-LbuCas13a was a gift from Jennifer Doudna (Addgene plasmid # 172488 ; http://n2t.net/addgene:172488 ; RRID:Addgene_172488)
  • For your References section:

    Accelerated RNA detection using tandem CRISPR nucleases. Liu TY, Knott GJ, Smock DCJ, Desmarais JJ, Son S, Bhuiya A, Jakhanwal S, Prywes N, Agrawal S, Diaz de Leon Derby M, Switz NA, Armstrong M, Harris AR, Charles EJ, Thornton BW, Fozouni P, Shu J, Stephens SI, Kumar GR, Zhao C, Mok A, Iavarone AT, Escajeda AM, McIntosh R, Kim S, Dugan EJ, Pollard KS, Tan MX, Ott M, Fletcher DA, Lareau LF, Hsu PD, Savage DF, Doudna JA. Nat Chem Biol. 2021 Sep;17(9):982-988. doi: 10.1038/s41589-021-00842-2. Epub 2021 Aug 5. 10.1038/s41589-021-00842-2 PubMed 34354262