Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pgRNA-backbone
(Plasmid #172517)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172517 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p426
  • Backbone manufacturer
    Mumberg et al. (Nucleic Acids Research, 1994, Vol. 22, No. 25)
  • Backbone size w/o insert (bp) 6145
  • Total vector size (bp) 8104
  • Modifications to backbone
    Removed 3 BsmBI/Esp3I restrictions sites
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA cassette
  • Species
    Synthetic
  • Insert Size (bp)
    1959
  • Promoter SNR52

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTAACCCTCACTAAAG
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Insert (gRNA cassette) from lentiCRISPR v2 (Addgene #52961); backbone from p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene #43803)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pgRNA-backbone was a gift from Leonid Kruglyak (Addgene plasmid # 172517 ; http://n2t.net/addgene:172517 ; RRID:Addgene_172517)
  • For your References section:

    Genome-wide base editor screen identifies regulators of protein abundance in yeast. Schubert OT, Bloom JS, Sadhu MJ, Kruglyak L. Elife. 2022 Nov 3;11. pii: 79525. doi: 10.7554/eLife.79525. 10.7554/eLife.79525 PubMed 36326816