Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti6.3delta4 GPR3-V5
(Plasmid #172601)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172601 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti6.3V5DEST
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 9387
  • Total vector size (bp) 10380
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    G protein-Coupled Receptor 3
  • Alt name
    GPR3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    993
  • Mutation
    WT
  • GenBank ID
    NM_005281.4
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti6.3delta4 GPR3-V5 was a gift from Robert Screaton (Addgene plasmid # 172601 ; http://n2t.net/addgene:172601 ; RRID:Addgene_172601)

  • For your References section:

    Silencing the G-protein coupled receptor 3-salt inducible kinase 2 pathway promotes human beta cell proliferation. Iorio C, Rourke JL, Wells L, Sakamaki JI, Moon E, Hu Q, Kin T, Screaton RA. Commun Biol. 2021 Jul 23;4(1):907. doi: 10.1038/s42003-021-02433-2. 10.1038/s42003-021-02433-2 PubMed 34302056
Related items: