PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP
(Plasmid
#172668)
-
PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172668 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3-U6-sgRNA-EGFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameALDOB pegRNA and ALDOB_nick-sgRNA
-
gRNA/shRNA sequenceccaccctgtgctgagtgtatgtttcagagctagaaatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctctctccctccaagacactcagcacagggttcactgccgtataggcagtagcttcctatccaatgccagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP was a gift from Xiaolong Wang (Addgene plasmid # 172668 ; http://n2t.net/addgene:172668 ; RRID:Addgene_172668) -
For your References section:
Enhancing prime editing by Csy4-mediated processing of pegRNA. Liu Y, Yang G, Huang S, Li X, Wang X, Li G, Chi T, Chen Y, Huang X, Wang X. Cell Res. 2021 Jun 8. pii: 10.1038/s41422-021-00520-x. doi: 10.1038/s41422-021-00520-x. 10.1038/s41422-021-00520-x PubMed 34103663