UBC1cer40GEM
(Plasmid
#172699)
-
PurposeUbiquitous expression of 60meric GEM monomer
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCambia1300
-
Backbone manufacturerpCambia
- Backbone size w/o insert (bp) 8900
- Total vector size (bp) 1200
-
Vector typePlant Expression, Unspecified
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemonomer of 60mer GEM
-
SpeciesA. thaliana (mustard weed); N. benthamiana
-
Insert Size (bp)3500
- Promoter UBC1
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTTTTCCCAGTCACGACGTTG
- 3′ sequencing primer TGAGCGGATAACAATTTCACACAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UBC1cer40GEM was a gift from Krishna Niyogi (Addgene plasmid # 172699 ; http://n2t.net/addgene:172699 ; RRID:Addgene_172699) -
For your References section:
Quantitative imaging of RNA polymerase II activity in plants reveals the single-cell basis of tissue-wide transcriptional dynamics. Alamos S, Reimer A, Niyogi KK, Garcia HG. Nat Plants. 2021 Aug;7(8):1037-1049. doi: 10.1038/s41477-021-00976-0. Epub 2021 Aug 9. 10.1038/s41477-021-00976-0 PubMed 34373604