Skip to main content

pX458_miR-290-295KO-gRNA2
(Plasmid #172710)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172710 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px458
  • Modifications to backbone
    KO of the whole cluster
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR-290-295
  • gRNA/shRNA sequence
    TGGTTGCTCCCATAGCACCT
  • Species
    M. musculus (mouse)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458_miR-290-295KO-gRNA2 was a gift from Constance Ciaudo (Addgene plasmid # 172710 ; http://n2t.net/addgene:172710 ; RRID:Addgene_172710)
  • For your References section:

    Global and precise identification of functional miRNA targets in mESCs by integrative analysis. Schaefer M, Nabih A, Spies D, Hermes V, Bodak M, Wischnewski H, Stalder P, Ngondo RP, Liechti LA, Sajic T, Aebersold R, Gatfield D, Ciaudo C. EMBO Rep. 2022 Jul 28:e54762. doi: 10.15252/embr.202254762. 10.15252/embr.202254762 PubMed 35899551