pX458_miR-290-295KO-gRNA3
(Plasmid
#172711)
-
PurposeCas9 with 5' gRNA for paired CRISPR KO of miR-290-295 cluster
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172711 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx458
-
Modifications to backboneKO of the whole cluster
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-290-295
-
gRNA/shRNA sequenceGGTCTACATAATTTCAAGGG
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458_miR-290-295KO-gRNA3 was a gift from Constance Ciaudo (Addgene plasmid # 172711 ; http://n2t.net/addgene:172711 ; RRID:Addgene_172711) -
For your References section:
Global and precise identification of functional miRNA targets in mESCs by integrative analysis. Schaefer M, Nabih A, Spies D, Hermes V, Bodak M, Wischnewski H, Stalder P, Ngondo RP, Liechti LA, Sajic T, Aebersold R, Gatfield D, Ciaudo C. EMBO Rep. 2022 Jul 28:e54762. doi: 10.15252/embr.202254762. 10.15252/embr.202254762 PubMed 35899551