pAG668 lifeAct-pFAST
(Plasmid
#172866)
-
PurposeExpresses LifeAct-pFAST in mammalian cells (actin labeling)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 3969
- Total vector size (bp) 4445
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLifeAct-pFAST
-
Alt namepFAST fused to LifeAct
-
SpeciesSynthetic
-
Insert Size (bp)477
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.01.29.428635v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG668 lifeAct-pFAST was a gift from Arnaud Gautier (Addgene plasmid # 172866 ; http://n2t.net/addgene:172866 ; RRID:Addgene_172866) -
For your References section:
Engineering of a fluorescent chemogenetic reporter with tunable color for advanced live-cell imaging. Benaissa H, Ounoughi K, Aujard I, Fischer E, Goiame R, Nguyen J, Tebo AG, Li C, Le Saux T, Bertolin G, Tramier M, Danglot L, Pietrancosta N, Morin X, Jullien L, Gautier A. Nat Commun. 2021 Nov 30;12(1):6989. doi: 10.1038/s41467-021-27334-0. 10.1038/s41467-021-27334-0 PubMed 34848727