pAG876 pDisplay-pFAST
(Plasmid
#172868)
-
Purposeexpresses pFAST at the surface of mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDisplay
- Total vector size (bp) 5680
-
Modifications to backbone5008
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepFAST-PDGFR
-
Alt namepFAST fused to PDGFR transmembrane protein
-
SpeciesSynthetic
-
Insert Size (bp)672
- Promoter CMV
-
Tags
/ Fusion Proteins
- IgK leader sequence (N terminal on insert)
- Myc tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.01.29.428635v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG876 pDisplay-pFAST was a gift from Arnaud Gautier (Addgene plasmid # 172868 ; http://n2t.net/addgene:172868 ; RRID:Addgene_172868) -
For your References section:
Engineering of a fluorescent chemogenetic reporter with tunable color for advanced live-cell imaging. Benaissa H, Ounoughi K, Aujard I, Fischer E, Goiame R, Nguyen J, Tebo AG, Li C, Le Saux T, Bertolin G, Tramier M, Danglot L, Pietrancosta N, Morin X, Jullien L, Gautier A. Nat Commun. 2021 Nov 30;12(1):6989. doi: 10.1038/s41467-021-27334-0. 10.1038/s41467-021-27334-0 PubMed 34848727