DHFR-GFP-th-NL1
(Plasmid
#173007)
-
PurposeFor light regulated release of neuroligin 1 from the endoplasmic reticulum. Driven by synapsin promoter. Thrombin site is included between GFP and NL1.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSynapsin
- Backbone size w/o insert (bp) 3858
- Total vector size (bp) 7497
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDHFR-GFP-NL1
-
Insert Size (bp)3639
- Promoter human synapsin
-
Tags
/ Fusion Proteins
- EGFP (N terminal on insert)
- DHFR (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer accatctgcgctgcgg
- 3′ sequencing primer CCATTATAAGCTGCAATAAACAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNeuroligin ORF was a gift from Dr. Peter Schieffele (Addgene clone #15262)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.09.02.278770v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DHFR-GFP-th-NL1 was a gift from Matthew Kennedy (Addgene plasmid # 173007 ; http://n2t.net/addgene:173007 ; RRID:Addgene_173007) -
For your References section:
zapERtrap: A light-regulated ER release system reveals unexpected neuronal trafficking pathways. Bourke AM, Schwartz SL, Bowen AB, Kleinjan MS, Winborn CS, Kareemo DJ, Gutnick A, Schwarz TL, Kennedy MJ. J Cell Biol. 2021 Sep 6;220(9). pii: 212461. doi: 10.1083/jcb.202103186. Epub 2021 Jul 9. 10.1083/jcb.202103186 PubMed 34241635