pVAX1-SARS-CoV-2-S HA-tag
(Plasmid
#173049)
-
PurposeMammalian expression plasmid for SARS-CoV-2 Spike in pVAX1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepVAX1
- Backbone size w/o insert (bp) -1
- Total vector size (bp) 6848
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 Spike
-
Alt namespike
-
Alt name2019-nCoV Spike
-
SpeciesSynthetic; Severe acute respiratory syndrome coronavirus 2
-
Insert Size (bp)3848
-
GenBank IDNC_045512.2 NC_045512.2
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI, KpnI (unknown if destroyed)
- 3′ cloning site BamHI,EcoRI (unknown if destroyed)
- 5′ sequencing primer caatgggagtttgttttggc
- 3′ sequencing primer ctggcaactagaaggcacag
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCourtesy of Prof Gary Wong and Prof Dimitri Lavillette
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVAX1-SARS-CoV-2-S HA-tag was a gift from Guangxun Meng (Addgene plasmid # 173049) -
For your References section:
SARS-CoV-2 spike engagement of ACE2 primes S2' site cleavage and fusion initiation. Yu S, Zheng X, Zhou B, Li J, Chen M, Deng R, Wong G, Lavillette D, Meng G. Proc Natl Acad Sci U S A. 2022 Jan 4;119(1). pii: 2111199119. doi: 10.1073/pnas.2111199119. 10.1073/pnas.2111199119 PubMed 34930824